Sequence ID | >WENV170016510 |
Genome ID | AZIK01011299 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 241 |
End posion on genome | 314 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tgtaaagtat |
tRNA gene sequence |
TGACCTATGGTGTAATGGTAACACACCTGGTTTTGGTCCAGGCATTTAAGGTTCGAGTCC |
Downstream region at tRNA end position |
aagcttctga |
Secondary structure (Cloverleaf model) | >WENV170016510 Gln TTG t ACAA aagcttctga T - A G - C A - T C - G C - G T - A A - T T G T A T T C C A A A G | | | | | G T T G T G T A A G G C G | | | | T T G A C A C T A A CATT C - G C - G T - A G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |