Sequence ID | >WENV170016511 |
Genome ID | AZIK01011344 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1487 |
End posion on genome | 1573 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
actctccaat |
tRNA gene sequence |
GGCGGCGTGGTGAAATTGGTAGACACGACGGATTCAAAATCCGTTGGGGTAAAACCCGTG |
Downstream region at tRNA end position |
tctttttttc |
Secondary structure (Cloverleaf model) | >WENV170016511 Leu CAA t ACCA tctttttttc G + T G - C C - G G - C G - C C - G G - C T G T C C G C C A T A A G | | | | | G T A G T G G G C G G C G | | | T T G A C A C T A G G TGGGGTAAAACCCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |