Sequence ID | >WENV170016512 |
Genome ID | AZIK01011376 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 136 |
End posion on genome | 51 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taacgtttta |
tRNA gene sequence |
GCCGACGTGGTGAAATTGGTAGACACGCCATCTTGAGGGGGTGGTGAGCTATGCTCGTGC |
Downstream region at tRNA end position |
tgttttacag |
Secondary structure (Cloverleaf model) | >WENV170016512 Leu GAG a ACCA tgttttacag G - C C - G C - G G - C A - T C - G G - C T G T C G G C C A T A A G | | | | | G T A G T G G C C G G C G | | | T T G A C A C T A G G TGAGCTATGCTCGT C - G C - G A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |