Sequence ID | >WENV170016515 |
Genome ID | AZIK01011467 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 48599 |
End posion on genome | 48513 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
atgatgattt |
tRNA gene sequence |
GCCAGAGTGGCGAAATTGGTAGACGCAGGGGATTCAAAATCCCCCGCCTTTGCGGGTGTG |
Downstream region at tRNA end position |
aattattgtt |
Secondary structure (Cloverleaf model) | >WENV170016515 Leu CAA t ACCA aattattgtt G + T C - G C - G A - T G - C A - T G - C T G T C G G C C A T A A G | | | | | G T A G C G G C C G G C G | | | T T G A C G C T A G A CGCCTTTGCGGGTGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |