Sequence ID | >WENV170016516 |
Genome ID | AZIK01011467 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 48454 |
End posion on genome | 48369 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ataacgtagg |
tRNA gene sequence |
GCCCAAGTGGTGGAATTGGTAGACACGCAGTGTTCAGGTCGCTGTGAGCTATGCTCGTGA |
Downstream region at tRNA end position |
tctctttttg |
Secondary structure (Cloverleaf model) | >WENV170016516 Leu CAG g ACCA tctctttttg G - C C - G C - G C - G A - T A - T G - C T G T C T C T C A T A A G | | | | | G T G G T G G A G A G C G | | | T T G A C A C T A G G TGAGCTATGCTCGT C - G A - T G - C T + G G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |