Sequence ID | >WENV170016521 |
Genome ID | AZIK01011533 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 274 |
End posion on genome | 199 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tgaaggttat |
tRNA gene sequence |
GCTCATGTAGCTCAGTAGGTAGAGCACACCCTTGGTAAGGGTGAGGTCACCGGTTCAAAT |
Downstream region at tRNA end position |
gtttccgggc |
Secondary structure (Cloverleaf model) | >WENV170016521 Thr GGT t TCCA gtttccgggc G - C C - G T - A C - G A - T T - A G - C T A T T G G C C A T G A A | | | | | A A C T C G A C C G G C G | | | | T T G G A G C T A A AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |