Sequence ID | >WENV170016522 |
Genome ID | AZIK01011553 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 59935 |
End posion on genome | 59860 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gcgcgccagt |
tRNA gene sequence |
CTCCTTATAGCTCAACAGGATAGAGCATCCGCCTCCTAAGCGGACGATCGGGGTTCGAGT |
Downstream region at tRNA end position |
ttgttagttt |
Secondary structure (Cloverleaf model) | >WENV170016522 Arg CCT t GCCA ttgttagttt C - G T - A C - G C - G T + G T + G A - T T G T G T C C C A C A A A | + | | | G A C T C G C G G G G C G | | | | T T G G A G C A T A A CGAT T - A C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |