Sequence ID | >WENV170016523 |
Genome ID | AZIK01011574 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1197 |
End posion on genome | 1282 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agcctcgcgt |
tRNA gene sequence |
GCCCGCGTGGTGGAATGGTAGACACATGAGACTTAAAATCTCCCGGCCGAATGGCCGTGC |
Downstream region at tRNA end position |
cgttttattt |
Secondary structure (Cloverleaf model) | >WENV170016523 Leu TAA t ACCA cgttttattt G - C C - G C - G C - G G - C C - G G - C T G T C G G C C A T A A G | | | | | G G G G T G G C C G G C G | | | T T T A C A C A G A CGGCCGAATGGCCGT T C G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |