Sequence ID | >WENV170016527 |
Genome ID | AZIK01011591 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 7111 |
End posion on genome | 7197 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgggactttt |
tRNA gene sequence |
GCCCGTGTGGTGGAATTGGTAGACACAGGGGATTCAAAATCCCCCGCTGTAACAGGCTTG |
Downstream region at tRNA end position |
ttattaaaag |
Secondary structure (Cloverleaf model) | >WENV170016527 Leu CAA t ACCA ttattaaaag G + T C - G C - G C - G G - C T - A G - C T G T C C G C C A T A A G | | | | | G T G G T G G G C G G C G | | | T T G A C A C T A G A CGCTGTAACAGGCTT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |