Sequence ID | >WENV170016529 |
Genome ID | AZIK01011598 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 205321 |
End posion on genome | 205237 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ggcctgaaat |
tRNA gene sequence |
GCGGAAGTGGTGAAATTGGTAGACACGCTGGATTTAGGTTCCAGTGCCGCAAGGCGTGAG |
Downstream region at tRNA end position |
atttacggag |
Secondary structure (Cloverleaf model) | >WENV170016529 Leu TAG t ACCA atttacggag G - C C - G G - C G - C A - T A - T G + T T G T C T C T C A T A A G | | | | | G T A G T G G A G A G C G | | | T T G A C A C T A G G TGCCGCAAGGCGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |