Sequence ID | >WENV170016534 |
Genome ID | AZIK01012241 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 636 |
End posion on genome | 710 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
atggaggaat |
tRNA gene sequence |
GGGTGTATAGCTCAGTGGTAGAGCACTTCGTTGACATCGAAGGGGTCACAAGTTCGAACC |
Downstream region at tRNA end position |
tcctccgccg |
Secondary structure (Cloverleaf model) | >WENV170016534 Val GAC t ACCA tcctccgccg G - C G - C G - C T + G G - C T - A A - T C A T T G T T C A G A A | | | | | G T C T C G A C A A G C G | | | | T T G G A G C T A A GGGTC C - G T - A T - A C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |