Sequence ID | >WENV170016535 |
Genome ID | AZIK01012243 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 5 |
End posion on genome | 91 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
nnnnnntcca |
tRNA gene sequence |
GCCCCGATGGTGAAATTGGTAGACACAAGGGACTTAAAATCCCTCGGCTGAAAGGCTGTA |
Downstream region at tRNA end position |
tcatttcaat |
Secondary structure (Cloverleaf model) | >WENV170016535 Leu TAA a ACCA tcatttcaat G - C C - G C - G C - G C - G G - C A - T T G T T G G C C A T A A G | | | | | G T A G T G A C C G G C G | | | T T G A C A C T A G A CGGCTGAAAGGCTGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |