Sequence ID | >WENV170016536 |
Genome ID | AZIK01012381 |
Phylum/Class | [AZIK] marine sediment metagenome; enrichment culture of sample MGS-ANC(AMM) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 1465 |
End posion on genome | 1390 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GTCCCCTTCGTCTAGTGGCCTAGGACTCCGCCCTTTCACGGCGGCAACAGGGGTTCGAAC |
Downstream region at tRNA end position |
atttttcttc |
Secondary structure (Cloverleaf model) | >WENV170016536 Glu TTC n GCCA atttttcttc G - C T - A C - G C - G C - G C - G T - A C A T T C C C C A T G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A T CAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |