Sequence ID | >WENV170017842 |
Genome ID | BARU01031993 |
Search identical group | |
Phylum/Class | [BARU] marine sediment metagenome; marine subsurface sediment at 18.6 meters below seafloor (mbsf), off the Shimokita Peninsula |
Species | |
Start position on genome | 169 |
End posion on genome | 93 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttttaaaaac |
tRNA gene sequence |
GGTGGCGTAGTTCAGTTGGTTAGAATGCCGGCCTGTCACGCCGGAGGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
ctgagttttt |
Secondary structure (Cloverleaf model) | >WENV170017842 Asp GTC c GCCA ctgagttttt G - C G - C T - A G - C G + T C - G G - C T G T T G C T C A T G A A + | | | | G T C T T G G C G A G C G | | | + T T G G A A T T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |