Sequence ID | >WENV170024529 |
Genome ID | BCQL01071092 |
Search identical group | |
Phylum/Class | [BCQL] museum specimen metagenome; Liagora japonica specimen isolated from Misaki, Miura, Kanagawa |
Species | |
Start position on genome | 20 |
End posion on genome | 104 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccaagataat |
tRNA gene sequence |
GCCGGTATGGTGAAATTGGTATACACGACGGATTCAAAATCCGTTGCCTTCGGGCGTGGC |
Downstream region at tRNA end position |
tattttaaga |
Secondary structure (Cloverleaf model) | >WENV170024529 Leu CAA t ACCA tattttaaga G + T C - G C - G G - C G - C T - A A - T T G T C C G C C A T A A G | | | | | A T A G T G G G C G G C G | | | T T G A C A C T A T G TGCCTTCGGGCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |