| Sequence ID | >WENV170025913 |
| Genome ID | CDTW01002197 |
| Phylum/Class | [CDTW] gut metagenome; human stools |
| Species | |
| Start position on genome | 32313 |
| End posion on genome | 32240 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
cctctgttgt |
| tRNA gene sequence |
GCGGGTATAGCTTAATGGTAAAGCTCCAGCCTTCCAAGCTGATCACACGGGTTCGATTCC |
| Downstream region at tRNA end position |
ttttttcatt |
| Secondary structure (Cloverleaf model) | >WENV170025913 Gly TCC
t TCCA ttttttcatt
G - C
C - G
G - C
G - C
G - C
T - A
A - T T T
T T G C C C A
A A A | | | | | G
T T T C G A C G G G C
G | | | | T T
G A A G C
T A T TCAC
C A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |