| Sequence ID | >WENV170026003 |
| Genome ID | CDTW01009235 |
| Phylum/Class | [CDTW] gut metagenome; human stools |
| Species | |
| Start position on genome | 6906 |
| End posion on genome | 6981 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
cgccatatat |
| tRNA gene sequence |
GCTGCTGTAGCTCAGTAGGTAGAGCGCATCCTTGGTAAGGATGAGGTCGGCGGTTCGAAT |
| Downstream region at tRNA end position |
cacaaaccct |
| Secondary structure (Cloverleaf model) | >WENV170026003 Thr GGT
t TCCA cacaaaccct
G - C
C - G
T - A
G - C
C - G
T - A
G - C T A
T C C G C C A
T G A A | | | | | G
A C T C G G G C G G C
G | | | | T T
G G A G C
T A G AGGTC
C - G
A - T
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |