| Sequence ID | >WENV170026015 |
| Genome ID | CDTW01010460 |
| Phylum/Class | [CDTW] gut metagenome; human stools |
| Species | |
| Start position on genome | 707 |
| End posion on genome | 631 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
gtgcaaaatt |
| tRNA gene sequence |
CGGGGTGTAGCTCAGCCTGGTAGAGTACTGCGTTCGGGACGCAGGTGTCGGAGGTTCGAA |
| Downstream region at tRNA end position |
atttcacgga |
| Secondary structure (Cloverleaf model) | >WENV170026015 Pro CGG
t ACCA atttcacgga
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T T C T C C A
C G A A + | | | | G
C C T C G G G A G G C
T | | | + T T
G G A G T
G T A A GTGTC
C - G
T - A
G - C
C - G
G - C
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |