| Sequence ID | >WENV170026064 |
| Genome ID | CDTW01014299 |
| Phylum/Class | [CDTW] gut metagenome; human stools |
| Species | |
| Start position on genome | 2591 |
| End posion on genome | 2517 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
ccccccccct |
| tRNA gene sequence |
GGCCCGATAGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGCAGCACGGGTTCAAATC |
| Downstream region at tRNA end position |
atatgtccaa |
| Secondary structure (Cloverleaf model) | >WENV170026064 Glu TTC
t ACCA atatgtccaa
G - C
G + T
C - G
C - G
C - G
G - C
A - T T A
T T G C C C A
C G A A | | | | | A
G A C T G A C G G G C
G | | | T T
T A G A C
T A A CAGC
C - G
C - G
G - C
C - G
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |