| Sequence ID | >WENV170026072 |
| Genome ID | CDTW01014437 |
| Phylum/Class | [CDTW] gut metagenome; human stools |
| Species | |
| Start position on genome | 8550 |
| End posion on genome | 8626 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
cttcatactt |
| tRNA gene sequence |
GCCTCCGTACCTCACCGGGATAGAGGGCCCGCCTCCTAAGCGGGATGTAGCGTGTTCGAG |
| Downstream region at tRNA end position |
caatccctta |
| Secondary structure (Cloverleaf model) | >WENV170026072 Arg CCT
t GCCA caatccctta
G + T
C - G
C - G
T + G
C - G
C - G
G - C T G
T C G C A C A
C C A A | | | | | G
G C T C C G C G T G C
G | | | | T T
G G A G G
A T A G ATGTA
C - G
C - G
C - G
G - C
C - G
C A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |