| Sequence ID | >WENV170026109 |
| Genome ID | CDTW01016930 |
| Phylum/Class | [CDTW] gut metagenome; human stools |
| Species | |
| Start position on genome | 54957 |
| End posion on genome | 54882 |
| Amino Acid | Ala |
| Anticodon | CGC |
| Upstream region at tRNA start position |
catgacattt |
| tRNA gene sequence |
GGGGATATAGCTCAGTTGGTAGAGCGCTGCGTTCGCAATGCAGAAGTCAGGGGTTCGAGT |
| Downstream region at tRNA end position |
tattaaggaa |
| Secondary structure (Cloverleaf model) | >WENV170026109 Ala CGC
t ACCA tattaaggaa
G - C
G - C
G + T
G - C
A - T
T - A
A - T T G
T T C C C C A
T G A A | | | | | G
T C T C G A G G G G C
G | | | | T T
G G A G C
T A G AAGTC
C - G
T - A
G - C
C - G
G + T
T A
T A
C G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |