| Sequence ID | >WENV170026196 |
| Genome ID | CDTW01025436 |
| Phylum/Class | [CDTW] gut metagenome; human stools |
| Species | |
| Start position on genome | 131 |
| End posion on genome | 206 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
caccattaat |
| tRNA gene sequence |
GCCGGAATAGCTCAATTGGTAGAGCAACTGACTTGTAATCAGTAGGTTGTGGGTTCAAGT |
| Downstream region at tRNA end position |
ctttaatgga |
| Secondary structure (Cloverleaf model) | >WENV170026196 Thr TGT
t ACCA ctttaatgga
G - C
C - G
C - G
G - C
G - C
A - T
A - T T G
T T A T C C A
T A A A + | + | | A
T C T C G G T G G G C
G | | | | T T
G G A G C
T A A AGGTT
A - T
C - G
T - A
G - C
A - T
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |