| Sequence ID | >WENV170026558 |
| Genome ID | CDTW01050404 |
| Phylum/Class | [CDTW] gut metagenome; human stools |
| Species | |
| Start position on genome | 1164 |
| End posion on genome | 1239 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
gcggacatac |
| tRNA gene sequence |
GCTGGTGTAGCTCAGCAGGCAGAGCGGCGCACTCGTAATGCGTAGGTCGACGGTTCAAAT |
| Downstream region at tRNA end position |
aaaatgaata |
| Secondary structure (Cloverleaf model) | >WENV170026558 Thr CGT
c TCCA aaaatgaata
G - C
C - G
T - A
G - C
G - C
T T
G - C T A
T C T G C C A
C G A A | | | | | A
A C T C G G A C G G C
G | | | | T T
G G A G C
C A G AGGTC
G + T
C - G
G - C
C - G
A - T
C A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |