| Sequence ID | >WENV170029588 |
| Genome ID | CDYG01026867 |
| Phylum/Class | [CDYG] gut metagenome; human stools |
| Species | |
| Start position on genome | 683 |
| End posion on genome | 593 |
| Amino Acid | Ser |
| Anticodon | TGA |
| Upstream region at tRNA start position |
tcttattaat |
| tRNA gene sequence |
GGAAGGGTGGCAGAGTTGGCTTAATGCGGCAGTCTTGAAAACTGTTGGTCGTGTAACAGC |
| Downstream region at tRNA end position |
attaatttat |
| Secondary structure (Cloverleaf model) | >WENV170029588 Ser TGA
t TCtt attaatttat
G - C
G - C
A - T
A - T
G - C
G - C
G + T T A
T G T C C C A
T T G A G | | | | | G
G G A C G C A G G G C
G | | | T T
C A T G C
T T A G TGGTCGTGTAACAGCGATCC
G + T
C - G
A - T
G - C
T - A
C A
T A
T G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |