Sequence ID | >WENV170031122 |
Genome ID | CDYI01042055 |
Search identical group | |
Phylum/Class | [CDYI] gut metagenome; human stools |
Species | |
Start position on genome | 10186 |
End posion on genome | 10259 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
attaataaac |
tRNA gene sequence |
GCGCTTCTAGCTCATTTGGTAGAGCACCTGACTCTTAATCAGGGTGTGCAGGGTTCGAGC |
Downstream region at tRNA end position |
aaaggtaccg |
Secondary structure (Cloverleaf model) | >WENV170031122 Lys CTT c ACtc aaaggtaccg G - C C - G G - C C - G T + G T - A C - G C G T G T C C C A T T A A | | | | | G T C T C G C A G G G C G | | | | T T G G A G C T A A GTGTG C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |