| Sequence ID | >WENV170035059 |
| Genome ID | CDYM01000913 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 73873 |
| End posion on genome | 73798 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
atccgcaatt |
| tRNA gene sequence |
CGGGGTGTAGCTCAGCCCGGTTAGAGTACGCGTCTGGGGGGCGTGTGGTCGCTGGTTCGA |
| Downstream region at tRNA end position |
gtaaaaatga |
| Secondary structure (Cloverleaf model) | >WENV170035059 Pro GGG
t ACtg gtaaaaatga
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T T G A C C A
C C G A A + | | | | G
C C T C G G C T G G C
G | | | + T T
G G A G T
T T A A TGGTC
C - G
G + T
C - G
G - C
T + G
C G
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |