| Sequence ID | >WENV170035073 |
| Genome ID | CDYM01001563 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 56662 |
| End posion on genome | 56736 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
agctttacaa |
| tRNA gene sequence |
GGCTCCATAGTTCAAGGGATAGAACGGAAGTTTCCTAAACTTCAAATTCGCGTTCGAGTC |
| Downstream region at tRNA end position |
tcttctcttc |
| Secondary structure (Cloverleaf model) | >WENV170035073 Arg CCT
a ACTA tcttctcttc
G + T
G - C
C - G
T - A
C - G
C - G
A - T T G
T G G C G C A
G A A A + | | | | G
G C T T G T C G C G C
G | | | | T T
A G A A C
T A G AAAT
G - C
A - T
A - T
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |