| Sequence ID | >WENV170035098 |
| Genome ID | CDYM01002128 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 1203 |
| End posion on genome | 1128 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
cacaaaatat |
| tRNA gene sequence |
GCTTCTATAGCTCAGTAGGTAGAGCACAGCCATGGTAAGGCTGGGGTCGCCGGTTCGATT |
| Downstream region at tRNA end position |
ttttatgcat |
| Secondary structure (Cloverleaf model) | >WENV170035098 Thr GGT
t TCCA ttttatgcat
G - C
C - G
T - A
T - A
C - G
T + G
A - T T T
T C G G C C A
T G A A | | | | | G
A C T C G G C C G G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
A - T
G - C
C - G
C - G
A A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |