| Sequence ID | >WENV170035145 |
| Genome ID | CDYM01004270 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 13020 |
| End posion on genome | 13094 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
ttttatcaag |
| tRNA gene sequence |
GGCCCATTCGTCTATCGGCTAGGACGCAAGATTTTCATTCTTGAAAGAGGAGTTCGATTC |
| Downstream region at tRNA end position |
atataaaaat |
| Secondary structure (Cloverleaf model) | >WENV170035145 Glu TTC
g ACGA atataaaaat
G + T
G - C
C - G
C - G
C - G
A - T
T - A T T
T T C C T C A
C T A C | | | | | G
G T C T G A G G A G C
G + | | | T T
C G G A C
T A G AAAG
C - G
A - T
A - T
G - C
A - T
T T
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |