| Sequence ID | >WENV170035187 |
| Genome ID | CDYM01006563 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 32898 |
| End posion on genome | 32972 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
acccgcaatt |
| tRNA gene sequence |
CGGGATGTAGCTCAGCCCGGTAGAGTACGCGTCTGGGGGGCGTGTGGTCGCAAGTTCGAA |
| Downstream region at tRNA end position |
ttgagcattg |
| Secondary structure (Cloverleaf model) | >WENV170035187 Pro GGG
t ACtg ttgagcattg
C - G
G - C
G - C
G - C
A - T
T - A
G - C T A
T T G T T C A
C G A A + | | | | G
C C T C G G C A A G C
C | | | + T T
G G A G T
G T A A TGGTC
C - G
G + T
C - G
G - C
T + G
C G
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |