| Sequence ID | >WENV170035198 |
| Genome ID | CDYM01006909 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 28892 |
| End posion on genome | 28818 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
tttttagctt |
| tRNA gene sequence |
GCCTCTTTAGCTCAGTTGGCCAGAGCACGTGATTTGTAATCTCGGGGTCGTTGGTTCGAA |
| Downstream region at tRNA end position |
tcaaggatga |
| Secondary structure (Cloverleaf model) | >WENV170035198 Thr TGT
t TCgc tcaaggatga
G - C
C - G
C - G
T - A
C - G
T - A
T - A T A
T C A G C C A
T G A A | | + | | G
T C T C G G T T G G C
G | | | | T T
G G A G C
C C A A GGGTC
C - G
G - C
T T
G - C
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |