| Sequence ID | >WENV170035240 |
| Genome ID | CDYM01008471 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 174234 |
| End posion on genome | 174150 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
gaattattcc |
| tRNA gene sequence |
GCGGATGTGGCGTAATTGGCAGCCGCGCCAGACTTAGGATCTGGTGCCGTGAGGCGTGTA |
| Downstream region at tRNA end position |
tccctataat |
| Secondary structure (Cloverleaf model) | >WENV170035240 Leu TAG
c ACAA tccctataat
G - C
C - G
G - C
G - C
A - T
T - A
G - C T G
T T A T C C A
T A A G + | | | | G
T T G C G G T A G G C
G | | | T T
G C C G C
C A G G TGCCGTGAGGCGT
C - G
C - G
A - T
G - C
A - T
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |