| Sequence ID | >WENV170035257 |
| Genome ID | CDYM01009627 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 29061 |
| End posion on genome | 28989 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
ttctccgaat |
| tRNA gene sequence |
GCGGGAGTAGCTCAGTGGTAGAGCATCAGCTTCCCAAGCTGAGGGTCGCGGGTTCGAGCC |
| Downstream region at tRNA end position |
gaggtccttt |
| Secondary structure (Cloverleaf model) | >WENV170035257 Gly CCC
t TCac gaggtccttt
G - C
C - G
G - C
G - C
G - C
A - T
G + T C G
T T G C C C A
G A A + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A A GGGTC
T - A
C - G
A - T
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |