| Sequence ID | >WENV170035263 |
| Genome ID | CDYM01009631 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 25778 |
| End posion on genome | 25689 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
tgcgtaacgt |
| tRNA gene sequence |
GGAGTCATGCCTGAGTGGCCGATAGGGGCACCCTGCTAAGGTGTTAGTCGTGTAAACGGC |
| Downstream region at tRNA end position |
gcacgggctt |
| Secondary structure (Cloverleaf model) | >WENV170035263 Ser GCT
t GCAA gcacgggctt
G - C
G - C
A - T
G - C
T - A
C - G
A - T T A
T C T C C C A
T G A G | | | | | G
G G T C C G A G G G C
G + | | | T T
C T A G G
C G A G TAGTCGTGTAAACGGCTC
G + T
C - G
A - T
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |