| Sequence ID | >WENV170035279 |
| Genome ID | CDYM01009960 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 2164 |
| End posion on genome | 2088 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
atatttttat |
| tRNA gene sequence |
TCTTCAGTAGCTCAGTCGGTTAGAGCATCTGACTGTTAATCAGAGGGTCGTTGGTTCAAG |
| Downstream region at tRNA end position |
attttgatat |
| Secondary structure (Cloverleaf model) | >WENV170035279 Asn GTT
t GCCG attttgatat
T - A
C - G
T - A
T - A
C - G
A - T
G - C T G
T C A A C C A
T G A A | | | | | A
C C T C G G T T G G C
G | | | | T T
G G A G C
T T A A GGGTC
T - A
C - G
T - A
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |