| Sequence ID | >WENV170035290 |
| Genome ID | CDYM01010541 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 4028 |
| End posion on genome | 4104 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
aatgttgcaa |
| tRNA gene sequence |
CGGGATGTAGCGCAGTTTGGTAGCGCACACGTCTGGGGGGCGTGGAGTCGCAAGTTCAAG |
| Downstream region at tRNA end position |
actaaagcct |
| Secondary structure (Cloverleaf model) | >WENV170035290 Pro GGG
a ACCA actaaagcct
C - G
G - C
G - C
G - C
A - T
T - A
G - C T G
T T G T T C A
T G A A + | | | | A
T C G C G G C A A G C
T | | | | T T
G G C G C
G T A A GAGTC
C - G
A - T
C - G
G - C
T + G
C G
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |