| Sequence ID | >WENV170035303 |
| Genome ID | CDYM01010829 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 6291 |
| End posion on genome | 6215 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
attatttctc |
| tRNA gene sequence |
GGGGTATTAGCTCATCTGGCTAGAGCGTTAGACTGGCAGTCTAAAGGTGGCGAGTTCGAG |
| Downstream region at tRNA end position |
ttataaacct |
| Secondary structure (Cloverleaf model) | >WENV170035303 Ala GGC
c ACTA ttataaacct
G - C
G - C
G + T
G - C
T + G
A - T
T - A T G
T C G C T C A
C T A A | | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
C T A G AGGTG
T - A
T - A
A - T
G - C
A - T
C G
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |