| Sequence ID | >WENV170035313 |
| Genome ID | CDYM01011941 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 181674 |
| End posion on genome | 181750 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
gtttcgaaat |
| tRNA gene sequence |
GCCTGAATAGCTCAGTTGGTTAGAGCACATGACTGTTAATCATGGGGTCCTAGGTTCAAG |
| Downstream region at tRNA end position |
atgcgcgagg |
| Secondary structure (Cloverleaf model) | >WENV170035313 Asn GTT
t GCCA atgcgcgagg
G - C
C - G
C - G
T - A
G - C
A - T
A - T T G
T G T T C C A
T G A A | | | | A
T C T C G C T A G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
A - T
T - A
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |