| Sequence ID | >WENV170035339 |
| Genome ID | CDYM01012871 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 3885 |
| End posion on genome | 3969 |
| Amino Acid | Leu |
| Anticodon | CAG |
| Upstream region at tRNA start position |
attccatgat |
| tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCACGTTTCAGGTGCGTGTGTCGAGAGGCGTGCA |
| Downstream region at tRNA end position |
gaaccccgtc |
| Secondary structure (Cloverleaf model) | >WENV170035339 Leu CAG
t ACCA gaaccccgtc
G - C
C - G
C - G
C - G
A - T
G - C
G - C T C
T T G T C C A
T A A G + | | | | G
T G G C G G C A G G C
G | | | T T
G A C G C
T A G G TGTCGAGAGGCGT
C - G
A - T
C - G
G - C
T + G
T T
T G
C A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |