| Sequence ID | >WENV170035344 |
| Genome ID | CDYM01013172 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 1021 |
| End posion on genome | 1095 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
cgactcttac |
| tRNA gene sequence |
GGGGGATTAGCTCAGCTGGCTAGAGCATCTGCCTTGCACGCAGAGGGTCAACGGTTCGAA |
| Downstream region at tRNA end position |
ccccagcaat |
| Secondary structure (Cloverleaf model) | >WENV170035344 Ala TGC
c ACat ccccagcaat
G - C
G - C
G + T
G - C
G + T
A - T
T - A T A
T T T G C C A
C G A A | | | | | G
T C T C G A A C G G C
G | | | | T T
G G A G C
C T A A GGGTC
T - A
C - G
T - A
G - C
C - G
C C
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |