| Sequence ID | >WENV170035367 |
| Genome ID | CDYM01014420 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 63488 |
| End posion on genome | 63417 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
agcgacggat |
| tRNA gene sequence |
TGAGCTATGGTGTAATGGTAACACAGCAGATTTTGGTTCTGTCGTTTTGGGTTCGAGTCC |
| Downstream region at tRNA end position |
cagccgcaaa |
| Secondary structure (Cloverleaf model) | >WENV170035367 Gln TTG
t ACac cagccgcaaa
T - A
G - C
A - T
G - C
C - G
T - A
A - T T G
T A G C C C A
A A G | + | | | G
T T G T G T T G G G C
G | | | | T T
G A C A C
T A A CGTT
G + T
C - G
A - T
G - C
A - T
T T
T G
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |