| Sequence ID | >WENV170035394 |
| Genome ID | CDYM01015347 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 79630 |
| End posion on genome | 79706 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
ttgaattatt |
| tRNA gene sequence |
GGTGCGTTAGTTCAGTTGGTTAGAATACATGCCTGTCACGCATGGGGTCACGGGTTCGAG |
| Downstream region at tRNA end position |
aagtcttttt |
| Secondary structure (Cloverleaf model) | >WENV170035394 Asp GTC
t GCAA aagtcttttt
G - C
G - C
T - A
G - C
C - G
G - C
T - A T G
T T G C C C A
T G A A | | | | | G
T C T T G A C G G G C
G | | | + T T
G G A A T
T T A A GGGTC
C - G
A - T
T - A
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |