| Sequence ID | >WENV170035497 |
| Genome ID | CDYM01019987 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 450 |
| End posion on genome | 377 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
acgaaaaaat |
| tRNA gene sequence |
GCGGAAATAGCTCAGTTGGTAGAGCATAACCTTGCCAAGGTTAGGGTCGCGAGTTCGAGT |
| Downstream region at tRNA end position |
gtttctttga |
| Secondary structure (Cloverleaf model) | >WENV170035497 Gly GCC
t TCat gtttctttga
G - C
C - G
G - C
G - C
A - T
A - T
A - T T G
T T G C T C A
T G A A + | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
T A A GGGTC
T - A
A - T
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |