| Sequence ID | >WENV170035509 |
| Genome ID | CDYM01020436 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 1054 |
| End posion on genome | 978 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
aagaaacaat |
| tRNA gene sequence |
GGCGGGATAGCTCAGCTGGTTAGAGCGCATGATTCATAATCATGAGGTCCCCGGTTCAAT |
| Downstream region at tRNA end position |
agccgaaagg |
| Secondary structure (Cloverleaf model) | >WENV170035509 Met CAT
t ACTA agccgaaagg
G + T
G - C
C - G
G - C
G - C
G - C
A - T C T
T G G G C C A
C G A A | | | | | A
T C T C G C C C G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
T - A
G - C
A - T
T A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |