| Sequence ID | >WENV170035515 |
| Genome ID | CDYM01020534 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 295 |
| End posion on genome | 377 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
ttttgtataa |
| tRNA gene sequence |
GCGGGGGTGCCCGAGAGGCCAAAGGGGACAGGCTTAGGACCTGTTGACGCAGGTCTACCA |
| Downstream region at tRNA end position |
taacaatttt |
| Secondary structure (Cloverleaf model) | >WENV170035515 Leu TAG
a Attc taacaatttt
G - C
C - G
G - C
G - C
G - C
G + T
G - C T A
T G T C C C A
A G A G | | | | | A
G G C C C C A G G G C
G | | | T T
C A G G G
C A A G TGACGCAGGTCTAC
A - T
C - G
A - T
G - C
G - C
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |