| Sequence ID | >WENV170035553 |
| Genome ID | CDYM01022417 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 229 |
| End posion on genome | 155 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
tacgccagtc |
| tRNA gene sequence |
GGTCCCGTAGCTCAGTTGGATAGAGCAGCAGATTTCTAATCTGCCGGCCGCGCGTTCGAG |
| Downstream region at tRNA end position |
ttttcctctt |
| Secondary structure (Cloverleaf model) | >WENV170035553 Arg TCT
c ACtt ttttcctctt
G - C
G + T
T - A
C - G
C - G
C - G
G - C C G
T C G C G C A
T G A A | | | | | G
T C T C G G C G C G C
G | | | | T T
G G A G C
A T A A CGGCC
G - C
C - G
A - T
G - C
A - T
T A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |