| Sequence ID | >WENV170035580 |
| Genome ID | CDYM01024137 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 157 |
| End posion on genome | 81 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
atttcatatg |
| tRNA gene sequence |
GTGGGTGTAGCGTAGTTGGTTAACGCGTCAGATTGTGGCTCTGAAGACCGAGGGTTCGAG |
| Downstream region at tRNA end position |
ttttcttttt |
| Secondary structure (Cloverleaf model) | >WENV170035580 His GTG
g CCCA ttttcttttt
G - C
T - A
G - C
G + T
G - C
T - A
G - C T G
T T T C C C A
T G A A + | | | | G
T T G C G G A G G G C
G | | | | T T
G A C G C
T T A G AGACC
T - A
C - G
A - T
G - C
A - T
T C
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |