| Sequence ID | >WENV170035608 |
| Genome ID | CDYM01024733 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 602 |
| End posion on genome | 676 |
| Amino Acid | Glu |
| Anticodon | CTC |
| Upstream region at tRNA start position |
atcaaactcc |
| tRNA gene sequence |
GGTGGGTTCGTCTAACGGTTAGGACACATGCCTCTCACGCATGTAATACGAGTTCGATTC |
| Downstream region at tRNA end position |
tctgattatc |
| Secondary structure (Cloverleaf model) | >WENV170035608 Glu CTC
c ACTA tctgattatc
G + T
G - C
T - A
G - C
G - C
G - C
T - A T T
T T G C T C A
C A A C | | | | | G
G T C T G A C G A G C
G + | | | T T
T G G A C
T A A TAAT
C - G
A - T
T - A
G - C
C - G
C C
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |