| Sequence ID | >WENV170035623 |
| Genome ID | CDYM01025502 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 39232 |
| End posion on genome | 39304 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
cgagttgttc |
| tRNA gene sequence |
GCCCCCATCGTCTAACGGTTAGGACACCAGACTTTCAATCTGACAACGAGAGTTCGACTC |
| Downstream region at tRNA end position |
cactaaagac |
| Secondary structure (Cloverleaf model) | >WENV170035623 Glu TTC
c ACtt cactaaagac
G + T
C - G
C - G
C - G
C - G
C - G
A - T T C
T C T C T C A
C A A C | | | | | G
G T C T G G A G A G C
G + | | | T T
T G G A C
T A A CAAC
C A
C - G
A - T
G - C
A - T
C A
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |