| Sequence ID | >WENV170035643 |
| Genome ID | CDYM01025818 |
| Phylum/Class | [CDYM] gut metagenome; human stools |
| Species | |
| Start position on genome | 109790 |
| End posion on genome | 109718 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
atgatgaccc |
| tRNA gene sequence |
GGGCGGTTGGCGCAGTGGTAGCGCACTTCCCTGACACGGAAGGGGTCACAAGTTCGAATC |
| Downstream region at tRNA end position |
gatgaatcgc |
| Secondary structure (Cloverleaf model) | >WENV170035643 Val GAC
c ACtc gatgaatcgc
G - C
G - C
G - C
C - G
G - C
G + T
T - A T A
T T G T T C A
G A G | | | | | G
T C G C G A C A A G C
G | | | | T T
G G C G C
T A A GGGTC
C - G
T - A
T - A
C - G
C - G
C C
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |